Skip to content

Ire57/Tadpole

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 

History

125 Commits
 
 
 
 
 
 
 
 
 
 

Repository files navigation

Team Barcelona-UB 2025 Software Tool: TADPOLE

Description

TADPOLE is a computational tool for identifying optimal linker sequences in functional RNA switches. It is designed to help you build your own RNA ON/OFF systems that reprogram translation through shape, not sequence.

Forget promoters, think aptamers. The future of regulation is here.

In short, you input your Structural RNA Element (SRE) and Aptamer, and the tool helps you turn them into a functional RNA switch. This means you can turn the function of your SRE on and off.


Usage

Online Tool (Recommended)

For a direct and user-friendly experience, TADPOLE is deployed as a web application. Use the tool online with no installation required at: https://toolkit-m4g6.onrender.com

Local Installation (For Developers)


Option 1: Package

For those who want to expand the code or run it locally.

Requirements

  • Python 3.8+: The project requires a recent version of Python.
  • Ghostscript: This is needed for structure visualisation.

Steps

  1. Clone the repository:

    git clone https://gitlab.igem.org/2025/software-tools/barcelona-ub/
  2. Install Ghostscript (Required for visualization):

    sudo apt-get update && sudo apt-get install -y ghostscript
  3. Set up a virtual environment (recommended):

    python3 -m venv venv_tadpole
    source venv_tadpole/bin/activate
  4. Install dependencies: Go to the the directory that contains requirements.txt.

    pip install -r requirements.txt
  5. Install the package: Go to the the directory that contains setup.txt.

    pip install .

Now, the tadpole package is installed locally and you can use its modules and the CLI. If you just want to run the streamlit app locally, run:

streamlit run app.py

Hoewever, if you want to use concrete functions to, for example, incorporate them on your workfow, you can run specific functions, defined in the cli.py file.

to run the Genetic Algorithm::

    tadpole ga_search \
--rna1_seq "ACCAGUGUGCGGAUGAUAACUACUGACGAAAGAGUCAUCGACUCAGUUAGUGGUUGGAUGUAGUCACAUUAGU" --rna3_seq      "AGUUGGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACCAAAA" --struct1 "((.(((((((......(((((((((((....(((((...))))).)))))))))))......).)))))).))"     --constraint "........................................................................................   <<<<<<<..............................." \
--mutable_rna1 1 2 4 5 6 7 8 9 \
--watched_positions 56 \
--output_dir "ga_test" \
--mfe_delta 0 \
--max_pairings_rna1_rna3 10 \
--max_structure_changes 6 \
--linker_length_ga 7 \
--num_mut 0 \
--verbose \
--population_size 50 \
--generations 100 \
--elitism_rate 0.1 \
--mutation_rate_rna1 0.02 \
--mutation_rate_linker 0.1 \
--tournament_size 3

For the Brute Force:

 tadpole linker_search --rna1_seq "ACCAGUGUGCGGAUGAUAACUACUGACGAAAGAGUCAUCGACUCAGUUAGUGGUUGGAUGUAGUCACAUUAGU" --rna3_seq    "AGUUGGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACCAAAA" --struct1 "((.(((((((......(((((((((((....(((((...))))).)))))))))))......).)))))).))"     --constraint "........................................................................................  <<<<<<<..............................." --linker_min 7 --linker_max 7 --mutable_rna1 1 2 4 5 6 7 8 9 --watched_positions 56 --mfe_delta   2.0 --max_pairings_rna1_rna3 10 --max_
structure_changes 6 --num_mut 0 --verbose --output_dir "linker_test"

You can also plot the Constrained and unconstrained structures from a sequence:

tadpole plot_structure \
--seq "AUCAGUGUGCGGAUGAUAACUACUGACGAAAGAGUCAUCGACUCAGUUAGUGGUUGGAUGUAGUCACAUUAAUAAAGACGAGUUGGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACCAAAA" \
--struct_unconstrained "....(.((((......(((((((((((....(((((...))))).)))))))))))(((((....)))))....(((((((((((((...)))))).)))))))..  ((((...)))))))))...." \
--struct_constrained "...(((((((......(((((((((((....(((((...))))).)))))))))))......).))))))............((((((...   ((((((((.....)))))...)))...)))))).." \
--rna1 "AUCAGUGUGCGGAUGAUAACUACUGACGAAAGAGUCAUCGACUCAGUUAGUGGUUGGAUGUAGUCACAUUAAU" \
--linker "AAAGACG" \
--rna3 "AGUUGGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACCAAAA" \
--mut1_info "[(1, 'C', 'U'), (71, 'G', 'A')]" \
--mfe_1 -43.1 \
--mfe_2 -39.0 \
--output_dir "plot_test_completo"

Or to use the evolutionary analysis tool, and analyse the most conserved structures, use

tadpole analyze_conservation --msa_file "examples/example.fasta" --output_dir "conservation_test"

Option 2: Docker Usage (Advanced)

For users who prefer a containerised, isolated environment.

Installation

Requirements

  • Docker Desktop: You must have Docker Desktop installed on your system.
  • WSL (Windows Subsystem for Linux): If you are on a Windows machine, ensure WSL is installed and that Docker is integrated with it.

Steps

  1. Open a terminal and clone the repository in your desired folder.

    git clone https://gitlab.igem.org/2025/software-tools/barcelona-ub/
  2. Navigate to the folder with the Dockerfile.

    cd barcelona-ub
  3. Open Docker Desktop and check that it is running.

    docker desktop

    If it is not installed, download Docker Desktop from https://www.docker.com/products/docker-desktop/, install, and open it. Image showing how to clone the repository with Docker Desktop open.

  4. Check for WSL integration if you are on Windows.

    wsl --version

    If not installed, run:

    wsl --install

    When using Windows, confirm that Docker is integrated with WSL by checking Docker Desktop → Settings → Resources → WSL Integration. Make sure this is checked:

    Image showing the "Enable integration with my default WSL distro" checkbox.

    For further confirmation, it should appear this when opening the Resources tab:

    Image showing the "Resources" tab in Docker Desktop.

  5. Build the Docker Image:

    docker build -t tadpole .

    It should take some time. Image showing the Docker image building process in the terminal. Check if the image is created by using the command line:

    docker ps

    Image showing the results of the "docker ps" command. Or use Docker Desktop: Image showing the "Images" tab in Docker Desktop.

  6. Run the Container:

    docker run -d -p 8501:8501 tadpole

    It is important that you only use port 8501, as any other port will not work. You can check the status of the image and container in the Docker Desktop, Images Tab: Image showing the running container in the Docker Desktop "Images" tab. Image showing the "Containers" tab in Docker Desktop with the running container.

  7. Access the Application: Then open a browser tab and navigate to:

    http://localhost:8501
    

    Image showing the TADPOLE application in a web browser.

  8. Container Management: Once finished, you can stop the container in Docker Desktop or by command.

    • To check running containers, look for the one with the tadpole image:
      docker ps
    • Copy the CONTAINER ID or NAMES, then run:
      docker stop <container_id_or_name>
    • In case you want to restart:
      docker start <container_id_or_name>
    • To remove/delete the container and image:
      • Container:
        docker rm <container_id_or_name>
      • Image:
        docker rmi <image_id_or_name>

    The last two steps can also be done using Docker Desktop.


API Usage (Limited)

To interact with TADPOLE's core functionality through a REST API.

  1. Start the API server: In the first terminal, navigate to the project directory and run the API script.

    python api_example.py

    This will start the development server at http://127.0.0.1:5000.

  2. Test the API endpoints: In a second terminal, run the test script to send requests to the endpoints.

    python test_api.py

    This will test the structure prediction, genetic algorithm, and linker search endpoints, and display the responses in your terminal.


Core Methodology

The design process is a multi-step pipeline based on computational and biological principles:

  • Constraint-Based Design: Users provide a desired "ON" state structure in dot-bracket notation as a constraint for the search algorithms.
  • Thermodynamic Prediction: ViennaRNA predicts Minimum Free Energy (MFE) secondary structures. The key evaluation metric is ΔMFE, the difference in MFE between the "ON" and "OFF" states.
  • Dual Search Algorithms:
    • Brute-Force Search: Explores every nucleotide combination. Guarantees all solutions but is only feasible for short linkers.
    • Genetic Algorithm (GA): Efficiently explores large design spaces via mutation, crossover, and a custom fitness function.
  • Evaluation: Candidates are assessed for:
    • ΔMFE: Difference between "ON" and "OFF" states.
    • SRE preservation: The "ON" state must maintain the functional SRE structure.
    • OFF-state disruption: The "OFF" state should disrupt the SRE.
    • Base pair interactions: Number and quality of pairings between system elements.
  • Structural and Diversity Analysis: Designs are clustered to identify structural families and assess diversity, helping users select unique and robust solutions. Image showing a diagramm of the Core Methotology

Standards and Interoperability

TADPOLE adheres to open standards and common file formats (e.g., FASTA). All valid designs are exported in SBOL3 JSON-LD format, ensuring compatibility with tools such as SynBioHub, SBOLDesigner, and other pipelines. This ensures results are FAIR: Findable, Accessible, Interoperable, and Reusable.


Software Architecture

TADPOLE is built with a modular Python architecture for clarity and maintainability:

Module Core Functionality
app.py Streamlit UI and workflow control
genetic_algorithm.py Core logic for the GA
search.py Brute-force search and filtering
input_utils.py Parsing of input files
rna_structures.py RNA structure parsing and manipulation
rna_mutation.py Functions for sequence mutation
structure.py RNA structure prediction (ViennaRNA)
conservation.py Sequence/structure conservation analysis
rna_cluster.py Structural clustering and diversity metrics
visualization.py Generation of RNA structure plots
SBOL.py Export to SBOL3 JSON-LD format
io_tools.py File I/O and ZIP archive creation

Outputs

Each run produces a ZIP archive containing:

  • report.txt: A detailed summary, including search parameters and results.
  • diversity.png: A bar plot of structural diversity (unique vs. total structures).
  • delta_mfe.png: A histogram of ΔMFE distribution, indicating switching efficiency.
  • sbol_document.jsonld: The final designs in machine-readable SBOL3 format.
  • plots/: A directory with high-resolution RNA structure plots highlighting SRE, linker, and aptamer.

Contributing

We welcome contributions! To contribute:

  1. Fork the repository and create a feature branch.
  2. Run tests and ensure code passes linting.
  3. Submit a pull request with a clear description of your changes.

Future Work:

  • Algorithm Expansion: Add more optimization strategies.
  • Aptamer Expansion: Test different aptamers and set default values automatically.
  • Experimental Validation: Protocols for synthesis, fluorescence assays...
  • Performance Optimization: Improve speed and reliability of core routines and external calls.

Authors and Acknowledgements

This software was developed by Team Barcelona-UB 2025.

Special thanks to:

  • The developers of ViennaRNA and SBOL for foundational tools and standards.
  • Open-source libraries: Streamlit, Biopython, and scikit-learn.
  • The iGEM Foundation for providing a platform and resources.

License

This software is licensed under the Creative Commons Attribution 4.0 International Public License (CC BY 4.0).

You are free to:

  • Share — copy and redistribute the material in any medium or format.
  • Adapt — remix, transform, and build upon the material, even commercially.

Under the following condition:

  • Attribution — You must give appropriate credit, provide a link to the license, and indicate if changes were made. You may do so in any reasonable manner, but not in a way that suggests the licensor endorses you or your use.

About

Toolkit for the design of an RNA-switch, using aptamers.

Topics

Resources

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published