HIV-1_5p_pseudoknot_domain continue_trace error

[IanWark]

output is: continue_trace: source type switch statement failed type: ÿ

Occurs with master branch and SHAPE branch with no shape data. Completes successfully with SHAPE data. I could post the structures some of the SHAPE ones predict if that would be useful but it's likely different.

On Compute Canada's Cedar, it took 30.5 hours and used 34 GB before failing.
The successful SHAPE run only took 30 hours and used 29 GB.

Sequence: GGUCUCUCUGGUUAGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACCCACUGCUUAAGCCUCAAUAAAGCUUGCCUUGAGUGCUCAAAGUAGUGUGUGCCCGUCUGUUGUGUGACUCUGGUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGUGUGGAAAAUCUCUAGCAGUGGCGCCCGAACAGGGACUUGAAAGCGAAAGUAAAGCCAGAGGAGAUCUCUCGACGCAGGACUCGGCUUGCUGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACUGGUGAGUACGCCAAAAAUUUUGACUAGCGGAGGCUAGAAGGAGAGAGAUGGGUGCGAGAGCGUCGGUAUUAAGCGGGGGAGAAUUAGAUAAAUGGGAAAAAAUUCGGUUAAGGCCAGGGGGAAAGAAACAAUAUAAACUAAAACAUAUAGUAUGGGCAAGCAGGGAGCUAGAACGAUUCGCAGUUAAUCCUGGCCUUUUAGAGACAUCAGAA

[PointlessUser]

Pinpointed it to the recompute_PX method and trace_PK method.

• When recompute_PX can't pair two values, it returns infinity.
• When recompute_PX returns infinity, the temp value in trace_PK goes above infinity
• When trace_PK's temp value goes above infinity, the if statement if (temp < min_energy) in trace_PK fails
• When the if statement fails, best_tgt_energy and best_tgt_type keep their default values
• best_tgt_type's default value is invalid, which causes the error continue_trace: source type switch statement failed type: ÿ

recompute_PX: https://github.com/HosnaJabbari/Knotty/blob/3fe1d2524abbd0a3bd94654e36dd31147e23cd02/src/pseudo_loop.cpp#L1238C1-L1246C6

trace_PK : https://github.com/HosnaJabbari/Knotty/blob/3fe1d2524abbd0a3bd94654e36dd31147e23cd02/src/pseudo_loop.cpp#L1077C5-L1100C2

switch statement (where the error happens): https://github.com/TheCOBRALab/Knotty/blob/3fe1d2524abbd0a3bd94654e36dd31147e23cd02/src/pseudo_loop.cpp#L4875C1-L4918C1

I also found that this sequence produces the same error which should help with rapid testing

./build/knotty AGGGCUAUCCUU

[mateog4712]

Known bug: Seems to occur with external pseudoknots with a single base pair